De novo acute B-cell acute Lymphoblastic Leukemia with BCL2/IGH and BCR/ABL1 rearrangements

Cytogenetics 

Short term cultures from bone marrow samples were performed at diagnosis and during the follow-up. Metaphases were analyzed after G-banding with Wright’stain. Karyotype was described according to the International System for Human Cytogenetic Nomenclature (ISCN 1995)(14–16).

FISH

FISH was performed on fixed cells. Directly labeled BCR and ABL probes (Vysis, Inc), producing a split of red signal when ABL is involved in genetic rearrangements. FISH data were collected with a fluorescence microscope (E 1000, Nikon Instruments) equipped with a CCD camera and Genikon software (Nikon Instruments). Two hundred nuclei/cells were analyzed for each experiment.

Molecular evaluation of BCL2/IGH rearrangement

Molecular evaluation was based on nested PCR(17). Mononuclear cells from BM and PB samples were obtained by Ficoll-Hypaque density gradient centrifugation. Genomic DNA was isolated from mononuclear cells using the QIAamp DNA mini kit (Qiagen, Hilden, Germany)(18). DNA integrity was assessed by amplifying a 510 bp fragment of the Beta-globin gene. Samples positive for Beta-globin were then investigated for the BCL2/IGH rearrangement using a nested PCR specific for MBR and mcr breakpoints. The first round of amplification was done using 1 microg of genomic DNA and the following primers: 5’–CAGCCTTGAAACATTGATGG–3’(forward, for MBR), 5’– CGTGCTGGTACCACTCCTG–3’ (forward, for mcr) and 5’–ACCTGAGGAGACGGTGACC–3’ (reverse, for the JH consensus region). An initial denaturation step of 5 min at 95° C was followed by amplification for 30 cycles (denaturation: 40 sec at 95° C; annealing: 40 sec at 55° C (MBR) or 58°C (mcr); extension: 50 sec at 72° C) and final extension for 7 min at 72° C. Reamplification of a 1 microL aliquot from a 1:50 dilution of the first PCR product was then performed using the internal primers: 5’–ATGGTGGTTTGACCTTTAG–3’ (forward, for MBR), 5’–GGACCTTCCTTGGTGTGTTG–3’ (forward, for mcr), 5’–ACCAGGGTCCCTTGGCCCCA–3’ (reverse, for the JH consensus region), and the following

PCR conditions: initial denaturation step of 5 min at 95° C; amplification for 35 cycles (denaturation: 40 sec at 95° C; annealing: 40 sec at 56° C (MBR) or 59°C (mcr); extension: 50 sec at 72° C); final extension for 7 min at 72° C. All PCR experiments were performed in 50 microL final volume containing 1U of Taq Gold DNA Polymerase (PE Applied Biosystems, San Francisco, USA), 10x PCR buffer, 100 mM of each dNTP, 2.5mM MgCl₂, and 1 microM of each primer. Samples were tested twice, and both positive and negative controls were included in all experiments. A patient-specific positive control was also included in every follow-up experiment to compare the BCL2/IGH fragment length with the PCR product obtained at the time of diagnosis. Amplified products were visualized on a 2% agarose gel stained with ethidium bromide. The sensitivity of the assay for the detection of BCL2/IGH rearrangement was routinely =10^-4.  

Molecular evaluation of BCR/ABL1 rearrangement

RNA extraction was performed by phenol/chloroform using bone marrow mononuclear cells obtained by Ficoll-Hypaque density gradient centrifugation. One microg of total RNA was reverse transcribed using random hexamer primers and MMLV reverse transcriptase; briefly, RNA was prewarmed for 10 min at 70°C and subsequently cooled for a further 10 min at 25°C. The RNA solution was then incubated for 42 min at 45°C in a 20 L reaction mixture containing 10 mM Tris

HCl (pH 8.3), 50 mM KCl, 5.5 mM MgCl2, 1 mM of each deoxyribonucleotide, 20 U of RNAsin

(Pharmacia, Upsala, Sweeden), 25 microM random hexamers (Pharmacia, Upssala, Sweeden), 10 mM of DTT (Pharmacia, Upssala, Sweeden), and 100U of MoMLV reverse transcriptase (BRL, Bethesda, MD). After incubation, cDNA solution was diluted 1:5 to 50 microL final volume. The cDNA integrity was assessed by amplifying a 296 bp fragment of the ABL1 gene. Samples positive for ABL1 were then investigated for the BCR/ABL1 rearrangement by qualitative PCR. Five microLs of cDNA were PCR-amplified using the following set of primers: EA500 5’ TGTGATTATAGCCTAAGACCCGGAG 3’, and R112 5’ TTGTCGTGTCCGAGGCCACC 3’. Thirty-five cycles of PCR were performed as follows: denaturation (30 sec at 96°C), annealing (30 sec at 60°C), and extension (30 sec at 72°C). Samples were tested twice, and both positive and negative controls were included in all experiments.

Amplified products were visualized on a 2% agarose gel stained with ethidium bromide (19).REF

Case report

In July 2020, a 40-years-old woman, presenting only with moderate fatigue, was diagnosed with pre-B ALL, L2 subtype. The peripheral blood count showed: Hb 9.3 g/dl; WBC 17x10⁹/L; PLT 56x10⁹/L. The bone marrow aspirate was hypocellular with 80% of lymphoid blasts. The karyotype was: 46,XX, del(6)(8q21q25), t(9;9)(p11;q22), t(14;18)(q32;q21)(10/20). The immuphenotype, assessed by flow cytometry, was: CD19+, CD22+, TdT+, CD20-, CD3-, CD10-.

The molecular analysis carried out by PCR confirmed a BCL2/IGH rearrangement (mcr breakpoint) but also unveiled a BCR/ABL1 (E1-A2 /p190) rearrangement. Thus, FISH analysis was also performed. The probe for BCR/ABL1 dual fusion gene gave two green signals and two red signals as expected from samples not carrying the ABL1 rearrangement. Molecular analysis was then repeated confirming the previous results. We administered a standard induction therapy (doxorubicine, vincristine, L-asparaginase, and prednisone plus imatinib), and an intensified consolidation therapy (idarubicine and high dose cytarabine) obtaining a molecular complete remission (CR). Particularly, neither BCL/IGH nor BCR/ABL1 rearrangements were detected. Other 2 consolidation courses were then administered (BFM-B regimen, including vincristine, ifosfamide, methothrexate, teniposide, high dose cytarabine, and dexamethasone; and BFM-A regimen, including vincristine, doxorubicine, cyclophosphamide, high dose methothrexate, and dexamethasone) associated with imatinib. Bone marrow harvest and autologous bone marrow transplantation were then performed, lacking a HLA-matched donor. Twelve months after the first documentation of CR, the patient relapsed. The bone marrow aspirate was hypercellular with 90% of leukemic cells. The karyotype was: 46 XX, t(1;5)(p32;q31), del(12)(p11;p13)(14/15); the molecular analysis conducted by PCR showed the BCL2/IGH rearrangement, whereas there was no evidence of the BCR/ABL1 fusion transcript. Salvage therapy with liposomal daunorubicin and intermediate dose cytarabine (23) was then administered, obtaining a second molecular CR (disappearance of BCL2/IGH). Two months later, a second relapse occurred. The karyotype was: 46 XX, t(1,5)(p32;q31), del(12)(p11;p13)(29/30). The molecular analysis showed again only the BCL2/IGH rearrangement, without evidence of the BCR/ABL1 fusion gene. Despite of neuro-meningeal prophylaxis, there was clinical evidence of CNS involvement. Compassionate treatment with campath-1H, 30 mg/dose, for 5 doses, was administered i. v., obtaining a peripheral blood blast clearance, but not a CR. The patients eventually died 17 months after diagnosis due to leukemic progression.